SLIIT International Conference on Advancements in Sciences and Humanities [SICASH] 2024
Permanent URI for this collectionhttps://rda.sliit.lk/handle/123456789/3833
Browse
79 results
Search Results
Publication Unknown Improving the Ability in Completi ng Written Exercises Properly: An Acti on Research Study(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Amarasena, K.A.; Janaki Aberathna, A.H.M.G.R.; Gamage, VThe subject of Informati on Technology has a prominent place in the current school curriculum due to its involvement in expanding the capacity, cogniti ve and psychomotor skills of an individual. The subject consists of both theoreti cal and practi cal areas. The ability to write proper answers for a given writt en exercise is a fundamental skill a student must have when studying Informati on Technology. While conducti ng the teaching learning process, the main problem encountered was the backwardness of student X in providing proper short answers to a given writt en exercise. Through data collecti on methods such as observati ons, interviews and documentary study, the nature of the problem was clearly investi gated. The current study was started with the intenti on of eliminati ng backwardness in providing proper short answers to a given writt en exercise. The literature review was done to orient the acti on research towards the correct directi on by getti ng an insight into implementi ng the interventi on plan. The preliminary functi onal plan was executed with three steps and the objecti ve was to moti vate the student to complete the given writt en exercise accurately. The second interventi on plan was implemented and completed with three steps. The objecti ve of the second interventi on was to build up the ability to construct a writt en answer logically and creati vely. Finally, the third interventi on step was executed with three steps to improve the ability in completi ng the writt en exercises properly. The qualitati ve analyti cal comparison was done among pre and post writt en answers of student X. There was a vivid positi ve improvement in the post writt en answer. Marks obtained for the structured essay part in the Informati on Technology subject had improved by eleven marks aft er conducti ng the acti on research. The current study thus demonstrates that there is a direct proporti onal relati onship between the variables of student performance and the student’s capability in completi ng the given writt en tasks.Publication Open Access From Classrooms to Conversati ons: Examining the Gap in English Language Speaking Skills among Sri Lankan English as a Second Language (ESL) Learners(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Rathnayaka, R.M.J.U.; Fernando, M.A.N.N.; George, L.V.; Dissanayake, D.M.M.S.The persistent struggle of Sri Lankan learners relati ng to spoken English profi ciency despite extensive formal instructi on conti nues to be a dominant issue in English language teaching and learning in the local context. Thus, with the objecti ve of fi nding out the underlying factors that contribute to the low competency in English language speaking skills of secondary level learners, this study was conducted based on the research questi on ‘what are the reasons that hinder the improvement in English language speaking of Sri Lankan ESL learners?’. Data collecti on included a mixed-method approach: a detailed questi onnaire was distributed, and interviews were conducted either face-to-face or online (via Zoom) with six educators and twenty-four students across the Western and Eastern provinces of Sri Lanka. The parti cipants included eighteen Sinhala and twelve Tamil speakers. The questi onnaires were subjected to quanti tati ve analysis using cross-tabulati on and descripti ve stati sti cs. Additi onally, for the interviews conducted, content analysis was employed. Furthermore, the Cross-Validati on approach was used to support the fi ndings. The analyses reveal several criti cal barriers to improving spoken profi ciency: inadequate educati onal resources, anti quated pedagogical practi ces, limited immersion in the language, and challenges with pronunciati on leading to an inhibiti on towards speaking English. Teachers mainly highlighted a predominance of conventi onal, grammar-centric teaching methods and the reluctance to uti lize available technological tools due to concerns about misuse and damage. The student parti cipants reported that their reluctance to practi ce speaking is due to fear of making errors and being negati vely judged, compounded by an excessive focus on examinati on success. Both teachers and students were of the view that examinati on papers prioriti se recepti ve skills over producti ve ones, thereby reinforcing a cycle of rote learning and exam-oriented instructi on. This study advocates for a reformati on in nati onal examinati ons to include assessments of producti ve skills, speaking and listening, to bett er refl ect comprehensive language competence. Additi onally, it is suggested that culti vati ng a genuine passion for English within students, despite existi ng constraints, could signifi cantly enhance their language acquisiti on and learning. Educators are encouraged to adopt more innovati ve and supporti ve teaching strategies that emphasize practi cal language use and student engagement.Publication Open Access Anglo Saxon English: A Linguistic Overview(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Karunanayaka, K. N. C. P.; Amaraweera, S; Wickremasinghe, S.SOriginated in England, English language is a West Germanic language that belongs to the Indo-European language family. From its introducti on to the Briti sh Isles, the tremendous changes it experienced shaped and developed it into the current lingua franca. In order for English to become a dominant and signifi cant language as it is now, it has gone through a development marked by signifi cant historical events and cultural exchanges. This study analyses Anglo Saxon English/Old English which is considered as the foundati on of Englishes that are spoken and studied today. The key area that is analysed in this study includes the morphological features of Anglo Saxon English along with its comparison to the Modern English translati on. Textual comparison is used for this purpose focusing on the historical poem: Caedmon’s Hymn. Furthermore, this research underscores how Old English morphology laid the groundwork for modern grammati cal structures. The study reveals a gradual simplifi cati on of infl ecti ons over ti me, which led to a more streamlined syntax. Understanding these historical transformati ons enhances our appreciati on of the language’s resilience and adaptability. The fi ndings of this study emphasise the signifi cance of historical linguisti c evoluti on in shaping English, highlighti ng the enduring impact of its Anglo-Saxon roots on contemporary language.Publication Open Access Adherence to the World Health Organizati on’s Pati ent Care Indicators in Outpati ent Department Dispensing at a Tertiary Care Hospital: A Cross-Secti onal Observati onal Study(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Sanjithakrishna, S.; Liyanaarachchie, L.C.P.T.; Krishnananthalingam, D; Bagyawantha, N.M.Y.K.The World Health Organizati on (WHO) has developed good dispensing practi ces (GDPs) to standardize the performance of pharmacists. Hence, they can be used as indicators to assess the quality of dispensing services. Evaluati ng the quality of dispensing is pivotal in improving dispensing practi ces in a healthcare insti tute. The objecti ve of this study was to assess the adherence of outpati ent department (OPD) pharmacists to WHO’s pati ent care indicators. This was a cross-secti onal, observati onal study conducted at the OPD pharmacy of the Teaching Hospital, Jaff na. Ethical approval was obtained from the ethics review committ ee, Faculty of Allied Health Sciences, University of Peradeniya. Eight pharmacists named A to G in the OPD were evaluated using a checklist by a single observer for about 10 dispensing cycles assessing average dispensing ti me, percentage of pati ents’ knowledge of correct dosage, percentage of drugs adequately labelled, and percentage of drugs dispensed resulti ng in the observati on of 78 dispensing cycles. Pati ent knowledge was assessed using a structured questi onnaire administered postdispensati on. These assessments were carried out in the real dispensing environment at the OPD, and the results were infl uenced by multi ple factors in the dispensing environment. The average dispensing ti me was 41.8 sec. Pharmacist A showed the highest dispensing ti me (55.7 sec) and pharmacist E showed the lowest dispensing ti me (31.0 sec). The percentage of drug knowledge among the pati ents varied between 50.0% to 65.0%. All the pharmacists adequately labelled the drugs during the dispensati on except pharmacist A (68.9%). Pharmacists B and C dispensed 100.0% of prescribed drugs. While adherence to certain WHO pati ent care indicators such as drug labelling and dispensing percentages were sati sfactory, the average dispensing ti me and pati ent knowledge were below WHO recommended standards.Publication Open Access Opti mization of DNA Extracti on and PCR Protocol to Explore Molecular Polymorphism of Artocarpus heterophyllus(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Sewmini, U.W.S.; Lankika, S.P.C.The Artocarpus heterophyllus, or jackfruit, is a tropical fruit tree that belongs to the Moraceae family and grows in Bangladesh, the East Indies, Malaysia, Southern China, India, Burma, and Sri Lanka. This crop is extremely valuable due to its ability to produce wood, medicine, and food. While morphological and molecular marker studies on the jack tree have been performed in other countries, there is a noticeable absence of similar studies in Sri Lanka. Recent discoveries of molecular markers have greatly expanded the possibilities for in-depth genetic research and increased the effectiveness of plant breeding initiatives. The current study was performed to optimize the DNA extraction procedure and PCR protocol of 10 jack tree varieties in Colombo, Gampaha, and Kalutara districts of the Western province of Sri Lanka to fill this gap. DNA was extracted using the standard CTAB method, which was improved with 1% 2-mercaptoethanol. Aft er DNA purifi cati on, a NanoDropTM spectrophotometer was used to quanti fy the DNA. The ISSR analysis used primer (TC)10G 5’TCTCTCTCTCTCTCTCTCTCG3’ and the amplifi ed DNA fragments were confi rmed and visualized using gel electrophoresis. In molecular study, the best extracti on effi ciency was shown by 2nd node and 3rd node leaf samples weighing between 150 300 mg, because of the relatively low polyphenol contents in immature leaves. The eff ecti ve preventi on of polyphenol oxidati on of DNA results in clear bands in the gel with the use of 1% 2 βmercaptoethanol in the extracti on procedure. DNAs with RNA contaminations were purifi ed by using 1% RNaseA. 3μl of RNaseA was added to each 50μl DNA sample. DNA yield ranges from 197.8 to 898.2 ng/μl, and purity ranges from 1.50 to 1.69, after genomic DNA samples tested between 260 and 280 nm in wavelength. In PCR amplification, the best results were obtained in a 25μl reaction mixture using 10X PCR buffer with 17.5mM MgCl2, 10mM dNTP mixture, 10pM ISSR primer, 1U Taq polymerase, and 40ng of genomic DNA. The thermocycler was programmed for an initial denaturati on at 94°C for 4 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 1 minute 30 seconds, extension at 72°C for 1 minute 50 seconds, and a fi nal extension at 72°C for 10 minutes. PCR products were resolved in 2% (w/v) agarose gel, visualized and documented using a Biobase gel documentati on system. Four bands with sizes ranging from 250 to 500 bp obtained from the experiment show the target PCR amplifi cati on. Furthermore, the disti nct band visible in the spermidine-treated sample indicates that spermidine reduces the PCR inhibitory effects of phenolics. Further studies are required to gain a better understanding of this species, providing useful insights for agricultural practices, conservation eff orts, and future genetic research.Publication Open Access Forming Policies for Ethical AI Use in Academic Writing(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Hussain, Z.DEasy access to generati ve AI has raised concerns about students’ engaging in academic dishonesty in their writi ng. AI in writi ng where a text writt en by an AI text generati ng soft ware is used and submitt ed for disseminati on or evaluati on is presented as the students’ own work can be considered to be plagiarism. Students in higher educati on insti tuti ons can be penalized if AI text is detected in their examinati ons. However, as AI text generators can also be used to support and improve a student’s writi ng, there is a questi on as to what extent and what types of usage of AI text generators can be considered as plagiarism. Thus, it would be of great advantage to students if their respecti ve higher educati on insti tuti ons can have clear guidelines and policies on AI use in students’ academic writi ng. This literature survey analyses the policies and instructi ons with regard to AI use in writi ng developed by the topmost universiti es in four English as a fi rst language countries, namely Melbourne (Australia), Auckland (New Zealand), Cambridge (UK) and Princeton (USA). The literature analysis parti cularly focused on the two themes of (1) instructi ons to academic staff and (2) instructors to students. Signifi cant instructi ons have been tabulated and discussed. They hold potenti al value as guidelines for considerati on when formulati ng and improving policies for local state and non-state higher educati onal insti tutes.Publication Open Access An Analysis on Word Formati on Processes among Young Adults in Sri Lanka(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Yasisuri, W.G.S.; Sivaji, K.The history of the English language identi fi ed two core varieti es: Briti sh English and American English. However, World Englishes have gained presti ge over the decades. English, therefore, has become the lingua franca in the world. As a result, Sri Lankan English has fascinati ngly become a specifi c variety. The people of a parti cular region or a country adapt English in specifi c ways, which are visible in their regular acti viti es such as at college, at supermarkets and at workplaces. Novel words can be found among several groups of people, which support the functi on of proper communicati on. Moreover, social media platf orms spread varied English morphemes. The younger generati on of Sri Lanka plays an innovati ve role in the process of word formati on. Therefore, this research focuses on specifi c word formati on processes in the Sri Lankan context among young adults. The objecti ves of this research are to recognize innovati ve word formati on processes in English in the Sri Lankan context and to analyse the use of these processes which are commonly used among young adults in Sri Lanka. The data relevant to word formati on processes were gathered by observing young adults’ speech on social media platf orms and daily speech practi ces of the parti cipants. The data collected were analyzed both quanti tati vely and qualitati vely. Furthermore, data was gathered via a questi onnaire distributed among the parti cipants. Eleven diff erent word formati on processes which were identi fi ed are analyzed in this research and they are also categorized under the most-used formati on processes and generally-used processes. The fi ndings indicate that novel word formati ons in English are explicitly visible among young adults in the Sri Lankan context. It was also found that most of these formati ons occur unintenti onally. This study is thus useful in identi fying the key word formati on processes prevalent in present Sri Lankan society and in understanding the future directi on of Sri Lankan English.Publication Open Access Prevalence of Postpartum Depression and Self-harming Ideation among Postnatal Mothers in Selected MOH Areas in the Western Province, Sri Lanka(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Ratnayake, S.M.S.; Nimeshika, K.M.H.; Senevirathna, S.P.T.A.; Tharuka, D.S.; Karunathilaka, M.A.N.; Wijewardhana, S.H.M.P.E.H.; De Silva, T.R.U.; Haq, M.R.I; Gunathilaka, T.L; Herath, H.M.C.M.Postpartum depression (PPD) is a form of depression that occurs in a postnatal mother following childbirth. Stati sti cs in 2018 esti mated that 17.7% of mothers experience PPD globally with a prevalence ranging from 7-33% in Asian countries. In South Asia, the reported prevalence ranges from 5-49%. A few studies have assessed its prevalence, and no research has been conducted in MOH areas of the Western Province. Additi onally, there is limited focus on assessing self-harming ideati on in mothers following delivery in Sri Lanka. This study aimed to determine the prevalence of PPD and self-harming ideati on among postnatal mothers in selected MOH areas in the Western Province of Sri Lanka. Mothers with PPD between 1 to 6 months postpartum were identi fi ed using a validated screening tool, the Edinburgh Postnatal Depression Scale (EDPS) with a cut-off mark of 9 or more through an intervieweradministered questi onnaire. Self-harming ideati on was assessed through the 10th questi on in the EDPS ‘The thoughts of harming myself has occurred to me’. A total of 422 mothers, selected using simple random sampling from 10 MOH areas across all three districts in the Western Province, parti cipated in the study, with a 100% response rate. PPD was evident in 97 mothers out of 422 scoring 9 or more on EDPS highlighti ng a prevalence of 22.99%. Additi onally, 35 mothers (8.29%) out of 422 were identi fi ed as having self-harming thoughts. Among these, 18 (51.42%) of mothers experienced such thoughts ‘hardly ever’, 15 (42.85%) ‘someti mes’, and 2 (5.71%) ‘quite oft en’. Approximately, one in fi ve mothers experience PPD and one in thirteen mothers experience selfharming ideati on. This emphasizes the signifi cance of addressing postnatal maternal health focusing on prenatal and postnatal care.Publication Open Access Exploration of Gender Identity as Experienced by the Transgender Community of Sri Lanka(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Edirisooriya, C; De Silva, R; De Silva, RaneeshaAmidst the socioeconomic advancements, the transgender community continues to endure marginalization, stigma, and discrimination. This persistent social reality underscores the urgent need to delve into the coping strategies employed by transgenders in navigating identity-related challenges and to assess the available psychosocial support systems. This study investigates perceptions of gender identity within the community and broader society, and the lived experiences of transgender individuals and their coping mechanisms. Employing a qualitative methodology, semi-structured interviews were conducted with ten transgender individuals, analyzing the data through thematic analysis. The data was obtained from a larger study that explored the Post-COVID Minority Distress and Resilience in Sri Lanka’s LGBTQIA+ Community. Findings illuminate the challenges faced, ranging from familial rejection to societal discrimination, including encounters with legal authorities. The perception of gender identity among transgender individuals is influenced by factors, including individual personality traits, available support networks, cultural context, awareness levels, and interactions within the community. While there has been a positive shift in societal attitudes in recent years, significant barriers persist, hindering full acceptance and integration of transgender identities. Despite the lack of formalized psychosocial support mechanisms, transgender individuals employ diverse coping strategies, including engagement with music, relaxation techniques, following religious practices, and withdrawing from social interactions to manage distress. In conclusion, while the existing community organizations offer vital support, the study findings underscore the need for comprehensive interventions spanning individual-level psychological support and systemic changes at the policy and legal levels. By addressing these multifaceted challenges and bolstering support structures, a more inclusive society can be fostered that affirms and supports the diverse identities within the transgender community.Publication Open Access Love and Marriage in the Eyes of Gen Z: A Qualitative Exploration(Faculty of Humanities and Sciences, SLIIT, 2024-12-04) Kulathunga, A; Abeysinghe, NLove and marriage are two interconnected concepts which serve as pillars of society. However, marriage rates are declining, and the percepti on of love changes with the newer generati ons. This study aims to explore the percepti on of love among Gen Zers in Sri Lanka and to understand the implicati ons of these percepti ons on marriage. A total of 11 parti cipants who belong to Generati on Z (age 18-26) were included in this study. Focus group and in-depth interviews were conducted to elicit the views on the related topic elements. This data was analysed using themati c analysis to identi fy the common themes presented within the data. Five main themes were constructed to explain the key ideas presented by the parti cipants. Namely: Views on love, Relati onship expectati ons and breakups, Views on marriage, marriage rates, and Role of culture. The results emerged showed that love is a crucial factor in marriage, especially in the newer generati ons because it has become a primary moti vator towards marriage in contrast to past generati ons where marriage was considered a social obligati on. However, the percepti on towards love has changed in the new generati ons, resulti ng in a decrease in marriage rates. This research off ers valuable insights into the evolving concepts of love and marriage in newer generati ons, emphasising the need for further explorati on to understand its broader implicati ons to the society.
